Paste a forward/reverse primer pair to calculate SantaLucia nearest-neighbor Tm and GC content, compare ΔTm, estimate a starting annealing temperature, and inspect hairpin, self-dimer, and heterodimer evidence.
Private by design: sequences and calculations stay in your browser. Privacy is separate from scientific validity; review the method and limits before using results in a protocol.
Primer-pair mode matches the PCR workflow. Enter every primer in the 5′→3′ direction.
This reproducible example uses 500 nM primer, 50 mM monovalent ions, 1.5 mM total Mg²⁺, 0.8 mM total dNTP, and no solvent additive in standard Taq mode.
Changing salt, free Mg²⁺, or primer concentration changes duplex stability in the model. Increasing DMSO from 0% to 5% lowers each displayed Tm by 3.75 °C; changing Mg²⁺ or dNTP can also change which Owczarzy salt regime applies.
Open the chemistry settings and model the actual Mg²⁺ and DMSO. Consider shifting or shortening a primer, and use a gradient rather than assuming the computed Tm is exact.
Try the upper part of the gradient, reduce primer or Mg²⁺ concentration, and verify genomic specificity with a genome-aware search. This calculator does not search a genome.
Try the lower gradient range, confirm primer orientation and template sequence, and check whether strong hairpin or 3′ dimer estimates could reduce available primer.
Prioritize heterodimers or self-dimers with a negative ΔG and 3′ involvement. Redesign the 3′ bases when possible; concentration and hot-start chemistry may also help.
If ΔTm exceeds 3 °C, shift the lower-Tm primer or change its length. Above 5 °C, redesign is usually more reliable than forcing a single annealing temperature.
Use a gradient for a new primer pair, uncertain buffer chemistry, GC-rich targets, or conflicting calculator results. The predicted range is a starting experiment.
Nearest-neighbor Tm. The calculator sums the ten SantaLucia 1998 DNA/DNA nearest-neighbor ΔH° and ΔS° parameters plus terminal initiation terms. For a non-self-complementary primer, Tm(K) = ΔH° × 1000 / [ΔS° + R ln(CT/4)], where R = 1.987 cal·K⁻¹·mol⁻¹. Automatic symmetry detection uses CT/2 and the −1.4 cal·K⁻¹·mol⁻¹ symmetry term.
Salt and solvents. The result applies the Owczarzy 2008 correction to 1/Tm, choosing monovalent-only, mixed-ion, or magnesium-dominant coefficients from √[free Mg²⁺]/[Mon⁺]. Free Mg²⁺ is approximated as max(total Mg²⁺ − total dNTP, 0). DMSO uses −0.75 °C per 1%, consistent with von Ahsen et al. 2001; formamide uses a clearly marked approximate −0.60 °C per 1%.
Structure estimates. Hairpin, self-dimer, and heterodimer searches enumerate ungapped complementary stems and report an approximate ΔG°37 from the same perfect-duplex nearest-neighbor parameters. Hairpins add a simple loop penalty. Mismatches, bulges, dangling ends, salt-dependent structure energies, kinetics, and ensemble populations are not modeled, so these values are screening evidence—not equivalent to a dedicated folding engine or an experiment.
| Published NN step | Expected ΔH° | Expected ΔS° | Calculator check |
|---|---|---|---|
| AA/TT | −7.9 kcal/mol | −22.2 cal/K·mol | Runs in browser |
| CG/GC | −10.6 kcal/mol | −27.2 cal/K·mol | Runs in browser |
| GC/CG | −9.8 kcal/mol | −24.4 cal/K·mol | Runs in browser |
| Biopython Tm_NN example: CGTTCCAAAGATGTGGGCATGAGCTTAC | 60.32 °C reference | 50 mM monovalent; effective concentration mapped to 100 nM CT under this page's CT/4 convention | Runs in browser |
Ranges and rounding. Inputs accept 2–100 nt after formatting removal, 1–10,000 nM primer, 0.1–1,000 mM monovalent ions, 0–20 mM Mg²⁺, 0–10 mM dNTP, and 0–20% solvent. Calculations keep full precision and display Tm/ΔG to one or two decimals. IUPAC mixtures are expanded up to 256 concrete variants and shown as a range; larger mixtures are rejected.
Limits. Tm is an equilibrium estimate for a perfect primer/template duplex, while annealing temperature is polymerase- and protocol-dependent. A Pass means only that the entered sequence meets the visible heuristic checks. It does not prove genomic specificity, amplification efficiency, absence of off-targets, or clinical suitability.
References: SantaLucia J. (1998), PNAS 95:1460–1465; Owczarzy et al. (2008), Biochemistry 47:5336–5353; von Ahsen et al. (2001), Clinical Chemistry 47:1956–1961; Biopython MeltingTemp reference example.
Optional compact mode: one pair per line as name, forward, reverse. Uses the conditions currently selected above; maximum 25 pairs.
The primary result uses SantaLucia 1998 DNA nearest-neighbor enthalpy and entropy values, strand concentration, and an Owczarzy 2008 correction for monovalent ions and free Mg²⁺. DMSO and formamide offsets are then applied.
Use the nearest-neighbor value with concentrations that match your reaction. Wallace and GC formulas are rough secondary checks and are not used for the pair verdict or annealing estimate.
A difference of 2–3 °C or less is a useful starting target. Larger differences make one annealing step less suitable for both primers; more than 5 °C usually deserves redesign or experimental optimization.
This tool starts from the lower primer Tm and applies a reaction-context heuristic, then shows a gradient range. Treat it as a starting experiment: polymerase manufacturer guidance and an empirical gradient take precedence.
A common starting target is 40–60% GC and one to three G or C bases within the last five bases at the 3′ end. Template context and assay requirements can justify values outside those ranges.
Free Mg²⁺ and monovalent ions stabilize duplexes and generally raise Tm. dNTPs bind Mg²⁺, so the model subtracts total dNTP from total Mg²⁺. DMSO lowers the estimate by 0.75 °C per percent in this calculator.
A self-dimer forms between copies of one primer; a heterodimer forms between the forward and reverse primers. Interactions involving a 3′ end are more concerning because a polymerase may extend them.
Calculators may use different nearest-neighbor tables, salt corrections, free-Mg²⁺ assumptions, concentration conventions, solvent corrections, or polymerase-specific rules. Match the inputs and method before comparing results.
