PCR Primer Tm, GC Content & Annealing Temperature Calculator
Paste a forward/reverse primer pair to calculate SantaLucia nearest-neighbor Tm and GC content, compare ΔTm, estimate a starting annealing temperature, and inspect hairpin, self-dimer, and heterodimer evidence.
Private by design: sequences and calculations stay in your browser. Privacy is separate from scientific validity; review the method and limits before using results in a protocol.
Enter primers
Primer-pair mode matches the PCR workflow. Enter every primer in the 5′→3′ direction.
0 nt
Accepts FASTA headers, spaces, line breaks, numbering, A/C/G/T, and IUPAC degenerate bases.
0 nt
Paste the reverse primer as ordered, not its reverse complement.
Changes only the annealing-temperature heuristic, not primer Tm. Manufacturer-specific guidance takes precedence.
Advanced conditions
nM
Total concentration per strand; non-self-complementary Tm uses CT/4.
Enter valid forward and reverse primers. Results update automatically after a short pause, or use Calculate primer pair.
Method and validation: calculation v2.0, reviewed 14 July 2026. SantaLucia 1998 nearest-neighbor parameters; Owczarzy 2008 mixed-salt correction; three embedded parameter regression checks. Maintained by Starlight Robotics. Report a correction.
How to analyze a PCR primer pair
Paste the forward and reverse primer sequences in 5′→3′ orientation.
Choose standard Taq, high-fidelity PCR, or qPCR as the reaction context.
If needed, open Advanced conditions and enter the primer, monovalent-ion, Mg²⁺, dNTP, DMSO, and formamide concentrations.
Select Calculate primer pair, then review the verdict, both Tm values, ΔTm, annealing range, and structure evidence.
Worked PCR primer-pair example
This reproducible example uses 500 nM primer, 50 mM monovalent ions, 1.5 mM total Mg²⁺, 0.8 mM total dNTP, and no solvent additive in standard Taq mode.
Forward (5′→3′)
ACGTTGACCTGACTGACGTA
Calculated in your browser
Reverse (5′→3′)
TGCAGTACCGATGACCTGAA
Calculated in your browser
Pair interpretation
The lower-Tm primer controls the starting annealing estimate. Review the calculated ΔTm and structure flags rather than treating the example as a universal protocol.
Changing salt, free Mg²⁺, or primer concentration changes duplex stability in the model. Increasing DMSO from 0% to 5% lowers each displayed Tm by 3.75 °C; changing Mg²⁺ or dNTP can also change which Owczarzy salt regime applies.
PCR troubleshooting from these results
High-GC primers
Open the chemistry settings and model the actual Mg²⁺ and DMSO. Consider shifting or shortening a primer, and use a gradient rather than assuming the computed Tm is exact.
Nonspecific bands
Try the upper part of the gradient, reduce primer or Mg²⁺ concentration, and verify genomic specificity with a genome-aware search. This calculator does not search a genome.
No amplification
Try the lower gradient range, confirm primer orientation and template sequence, and check whether strong hairpin or 3′ dimer estimates could reduce available primer.
Primer-dimer bands
Prioritize heterodimers or self-dimers with a negative ΔG and 3′ involvement. Redesign the 3′ bases when possible; concentration and hot-start chemistry may also help.
Mismatched Tm values
If ΔTm exceeds 3 °C, shift the lower-Tm primer or change its length. Above 5 °C, redesign is usually more reliable than forcing a single annealing temperature.
When to use gradient PCR
Use a gradient for a new primer pair, uncertain buffer chemistry, GC-rich targets, or conflicting calculator results. The predicted range is a starting experiment.
Methods, equations, validation, and limits
Nearest-neighbor Tm. The calculator sums the ten SantaLucia 1998 DNA/DNA nearest-neighbor ΔH° and ΔS° parameters plus terminal initiation terms. For a non-self-complementary primer, Tm(K) = ΔH° × 1000 / [ΔS° + R ln(CT/4)], where R = 1.987 cal·K⁻¹·mol⁻¹. Automatic symmetry detection uses CT/2 and the −1.4 cal·K⁻¹·mol⁻¹ symmetry term.
Salt and solvents. The result applies the Owczarzy 2008 correction to 1/Tm, choosing monovalent-only, mixed-ion, or magnesium-dominant coefficients from √[free Mg²⁺]/[Mon⁺]. Free Mg²⁺ is approximated as max(total Mg²⁺ − total dNTP, 0). DMSO uses −0.75 °C per 1%, consistent with von Ahsen et al. 2001; formamide uses a clearly marked approximate −0.60 °C per 1%.
Structure estimates. Hairpin, self-dimer, and heterodimer searches enumerate ungapped complementary stems and report an approximate ΔG°37 from the same perfect-duplex nearest-neighbor parameters. Hairpins add a simple loop penalty. Mismatches, bulges, dangling ends, salt-dependent structure energies, kinetics, and ensemble populations are not modeled, so these values are screening evidence—not equivalent to a dedicated folding engine or an experiment.
Embedded parameter and reference-calculator validation
50 mM monovalent; effective concentration mapped to 100 nM CT under this page's CT/4 convention
Runs in browser
Ranges and rounding. Inputs accept 2–100 nt after formatting removal, 1–10,000 nM primer, 0.1–1,000 mM monovalent ions, 0–20 mM Mg²⁺, 0–10 mM dNTP, and 0–20% solvent. Calculations keep full precision and display Tm/ΔG to one or two decimals. IUPAC mixtures are expanded up to 256 concrete variants and shown as a range; larger mixtures are rejected.
Limits. Tm is an equilibrium estimate for a perfect primer/template duplex, while annealing temperature is polymerase- and protocol-dependent. A Pass means only that the entered sequence meets the visible heuristic checks. It does not prove genomic specificity, amplification efficiency, absence of off-targets, or clinical suitability.
Optional compact mode: one pair per line as name, forward, reverse. Uses the conditions currently selected above; maximum 25 pairs.
Commas or tabs are accepted. IUPAC bases are supported within the same 256-variant limit.
PCR primer calculator FAQ
How is primer Tm calculated?
The primary result uses SantaLucia 1998 DNA nearest-neighbor enthalpy and entropy values, strand concentration, and an Owczarzy 2008 correction for monovalent ions and free Mg²⁺. DMSO and formamide offsets are then applied.
Which primer Tm method should I use?
Use the nearest-neighbor value with concentrations that match your reaction. Wallace and GC formulas are rough secondary checks and are not used for the pair verdict or annealing estimate.
How far apart can forward and reverse primer Tm values be?
A difference of 2–3 °C or less is a useful starting target. Larger differences make one annealing step less suitable for both primers; more than 5 °C usually deserves redesign or experimental optimization.
How do I choose a PCR annealing temperature?
This tool starts from the lower primer Tm and applies a reaction-context heuristic, then shows a gradient range. Treat it as a starting experiment: polymerase manufacturer guidance and an empirical gradient take precedence.
What GC content and GC clamp are desirable?
A common starting target is 40–60% GC and one to three G or C bases within the last five bases at the 3′ end. Template context and assay requirements can justify values outside those ranges.
How do Mg²⁺, dNTPs, and DMSO affect primer Tm?
Free Mg²⁺ and monovalent ions stabilize duplexes and generally raise Tm. dNTPs bind Mg²⁺, so the model subtracts total dNTP from total Mg²⁺. DMSO lowers the estimate by 0.75 °C per percent in this calculator.
What is the difference between self-dimer and heterodimer risk?
A self-dimer forms between copies of one primer; a heterodimer forms between the forward and reverse primers. Interactions involving a 3′ end are more concerning because a polymerase may extend them.
Why do primer calculators return different Tm values?
Calculators may use different nearest-neighbor tables, salt corrections, free-Mg²⁺ assumptions, concentration conventions, solvent corrections, or polymerase-specific rules. Match the inputs and method before comparing results.